Headloop Primer Design

Design headloop primers for testing cutting efficiency of CRISPR/Cas9 guide RNAs.

Enter the left and right primers (for an amplicon covering the target guide sequence) and the guide RNA target plus 15 bp.

Two designs are produced. One with the headloop tag on the forward primer and one with it on the reverse primer. If the primer melting temperatures are significantly different, a warning is given.

The guide RNA sequence plus context should be the guide target sequence including PAM plus the next 15 bp. The sequence should come from the appropriate strand. For example, for the sequence shown below, with the guide target sequence on the forward strand and the PAM marked in red, the sequence to use is marked in bold

TGAATGATGAGGACAGACGTGTTTCTCCAGCGGAGGAAGCGTAGAGATGTTCTGCTCTCC

If the guide target sequence is on the reverse strand as shown below, the sequence to use would be the reverse complement of the sequence shown in bold.

CAGGTCGAGGGTTCTGTCAGGACGTCCTGGTGTCCGACCTTCCCAACGGGCCGCAGTAT

This app uses the Python Headloop module written by Gareth T. Powell.

Using headloop PCR to screen for CRISPR/Cas9 induced indels is described in Kroll et al. (2021).

A protocol is available.